Table 4 |
|||||
|
Germline MSH2 and MLH1 mutations in Polish HNPCC families |
|||||
|
Mut. No. |
Gene/exon or intron |
Position of nucleotide with mutation |
Consequence |
Number of families |
Reported in other populations |
|
|
|||||
|
1. |
MSH2/1 |
c.4 G>A |
A2T |
1 |
yes |
|
|
|||||
|
2. |
MSH2/1-6 |
unknown |
del ex1-6 in DNA1 |
1 |
? |
|
|
|||||
|
3. |
MSH2/2 |
del/ins2 |
Premature nonsense codon |
1 |
no |
|
|
|||||
|
4. |
MSH2/3-6 |
unknown |
del ex3-6 in DNA |
1 |
? |
|
|
|||||
|
5. |
MSH2/3 |
c.435T>G |
I45M |
1 |
yes |
|
|
|||||
|
6. |
MSH2/3 |
c.613G>T |
E205X |
1 |
no |
|
|
|||||
|
7. |
MSH2/SD3 |
c.645 + 1g>t |
del ex3 no reading frame shift |
1 |
no |
|
|
|||||
|
8. |
MSH2/4 |
c.715 C>T |
Q239X |
1 |
no |
|
|
|||||
|
9. |
MSH2/SD5 |
c.942 + 3a>t |
del ex5 no reading frame shift |
10 |
yes |
|
|
|||||
|
10. |
MSH2/7 |
c.1204C>T |
Q402X |
1 |
no |
|
|
|||||
|
11. |
MSH2/7 |
c.1215C>A |
Y405X |
1 |
no |
|
|
|||||
|
12. |
MSH2/7 |
c.1216C>T |
R406X |
2 |
yes |
|
|
|||||
|
13. |
MSH2/7-16 |
unknown |
del ex7-16 in DNA3 |
1 |
? |
|
|
|||||
|
14. |
MSH2/8 |
unknown |
del ex8 in DNA4 |
1 |
? |
|
|
|||||
|
15. |
MSH2/9 |
unknown |
del ex in DNA4 |
2 |
? |
|
|
|||||
|
16. |
MSH2/SD10 |
c.1661 + 5g>c |
del ex10 with reading frame shift |
1 |
no |
|
|
|||||
|
17. |
MSH2/11 |
c.1705-1706delGA |
reading frame shift |
1 |
no |
|
|
|||||
|
18. |
MSH2/12 |
c.1771-1772insA |
reading frame shift |
1 |
no |
|
|
|||||
|
19. |
MSH2/12 |
c.1968C>G |
R656X |
1 |
yes |
|
|
|||||
|
20. |
MSH2/13 |
c.2131C>T |
R711X |
1 |
yes |
|
|
|||||
|
21. |
MSH2/SD13 |
c.2210 + 1g>c |
del ex13 with reading frame shift |
1 |
no |
|
|
|||||
|
22. |
MSH2/14 |
c.2305delT |
reading frame shift |
1 |
no |
|
|
|||||
|
23. |
MSH2/14 |
c.2388delT |
reading frame shift |
1 |
no |
|
|
|||||
|
24. |
MSH2/14 |
c.2422G>T |
E808X |
2 |
no |
|
|
|||||
|
25. |
MSH2/SD15 |
c.2634 + 1g>a |
del ex15 with reading frame shift |
1 |
yes |
|
|
|||||
|
26. |
MLH1/1 |
c.37delG |
reading frame shift |
1 |
no |
|
|
|||||
|
27. |
MLH1/1 |
c.66delG |
reading frame shift |
1 |
yes |
|
|
|||||
|
28. |
MLH1/1 |
c.83C>T |
P28L |
3 |
yes |
|
|
|||||
|
29. |
MLH1/2 |
c.161delG |
reading frame shift |
1 |
no |
|
|
|||||
|
30. |
MLH1/2 |
c.184C>T |
Q62X |
2 |
yes |
|
|
|||||
|
31. |
MLH1/2 |
c.199G>A |
G67R |
1 |
yes |
|
|
|||||
|
32. |
MLH1/3 |
c.256C>T |
Q86X |
1 |
no |
|
|
|||||
|
33. |
MLH1/4 |
c.350C>T |
T117M |
1 |
yes |
|
|
|||||
|
34. |
MLH1/4 |
c.356-357insAA |
reading frame shift |
1 |
no |
|
|
|||||
|
35. |
MLH1/5 |
c.392C>A |
S131X |
1 |
no |
|
|
|||||
|
36. |
MLH1/7SA |
c.546-2a>g |
del ex7 with reading frame shift |
1 |
yes |
|
|
|||||
|
37. |
MLH1/SD8 |
c.677G>T |
del ex8 with reading frame shift |
3 |
yes |
|
|
|||||
|
38. |
MLH1/10 |
g.37019613-37020677del1064 |
del ex10 in DNA4 |
1 |
no |
|
|
|||||
|
39. |
MLH1/SD10 |
c.883delAGgt |
del ex10 with reading frame shift |
1 |
no |
|
|
|||||
|
40. |
MLH1/SD10 |
c.883A>C (c.884-2A>C) |
del ex10 with reading frame shift |
1 |
no |
|
|
|||||
|
41. |
MLH1/12 |
c.1252-1253delGA |
reading frame shift |
1 |
no |
|
|
|||||
|
42. |
MLH1/12 |
c.1321G>A |
A441T |
3 |
yes |
|
|
|||||
|
43. |
MLH1/SD12 |
c.1409 + 1g>c |
del ex12 with reading frame shift |
1 |
yes |
|
|
|||||
|
44. |
MLH1/13 |
c.1489-1490insC |
reading frame shift |
3 |
yes |
|
|
|||||
|
45. |
MLH1/15 |
c.1672G>T |
E558X |
1 |
yes |
|
|
|||||
|
46. |
MLH1/15 |
c.1731G>A |
del ex15 with reading frame shift |
1 |
yes |
|
|
|||||
|
47. |
MLH1/16 |
c.1852-1854delAAG |
618delK |
1 |
yes |
|
|
|||||
|
48. |
MLH1/18 |
c.2040C>A |
C680X |
1 |
no |
|
|
|||||
|
49. |
MLH1/18 |
c.2041G>A |
A681T |
8 |
yes |
|
|
|||||
|
50. |
MLH1/19 |
c.2223delGCAGCTTGCTA |
reading frame shift |
1 |
no |
|
|
|||||
|
? - definite answer is difficult without breakpoint sequencing mutations not found previously in other populations shown in bold; 1probably no transcript of mutant allele; 2c.243delTAAAATGAATTTTGAATCTTTTGTAAAAGATinsCTGACAAGCGCCTATAGCA CTCGAATAATTCTTCTCACCCTAACAGGTCAGCCTCGCTTCCCAGCCCTCACTAACAT TAACGAAAACAACCCACCCTACTAAACCCCATTAAACGCCTAACAATCGGAAGCCTA TTTTGCAGGGTTTCTCCATCACCAACAGCATTCTCCCCACATCCACCCCCCAAATGAC AATCCCACTTTACTTAAAACTCACAG (premature nonsense codon in bold); 3 shorter transcript of allele with deletion; 4 exon deleted and reading frame shift. |
|||||
|
Kurzawski Hereditary Cancer in Clinical Practice 2006 4:197 doi:10.1186/1897-4287-4-4-197 |
|||||